Ago2 Antibody, Brachyury Antibody, Brn3A Antibody, Cd45Ro Antibody, Cdk5 Antibody, Erg Antibody, Foxa2 Antibody, Gerbil, Goat, Guinea, Hamster, Horse, Influenza, Insect, Jmjd3 Antibody, Kangaroo, Killifish, Klf2 Antibody, Lkb1 Antibody, Mobp Antibody, Rabbit, Raccoon, Rat, Tbp Antibody, Zeb2 Antibody

Genetic landscape of congenital disorders in patients from Southeast Asia: results from sequencing using a gene panel for Mendelian phenotypes

Goal: To check the utility and diagnostic yield of a medical-exome gene panel for figuring out pathogenic variants in Mendelian problems.


Strategies: Subsequent-generation sequencing was carried out with the TruSight One gene panel (concentrating on 4813 genes) adopted by MiSeq sequencing on 216 sufferers who offered with suspected genetic problems as assessed by their attending physicians.


Outcomes: There have been 56 pathogenic and 36 possible pathogenic variants throughout 57 genes recognized in 87 sufferers. Causal mutations have been extra prone to be truncating and from sufferers with a previous scientific analysis. One other 18 promising variants want additional analysis for extra proof to satisfy the requirement for potential improve to pathogenic. Forty-five of the 92 clinically important variants have been novel.


Conclusion: The 40.3% constructive yield compares favourably with related research utilizing both this panel or complete exome sequencing, demonstrating that enormous gene panels may very well be various to complete exome sequencing for fast genetic affirmation of Mendelian problems.


Affiliation between Main Healthcare and Medical Expenditures in a Context of Hospital-Oriented Healthcare System in China: A Nationwide Panel Dataset, 2012-2016


Whole well being expenditure in China has grown significantly since a brand new spherical of well being system reform was enacted in 2009. Researchers have proven that strengthening main healthcare could also be an choice for international locations to resolve the speedy enlargement of their medical expenditures. This research was designed to discover the affiliation between the energy of main healthcare and medical expenditures, within the context of the hospital-oriented healthcare system in China.

A longitudinal ecological research was carried out utilizing a 5-year panel dataset of 27 provinces in mainland China. The linear combined results regression mannequin was used to evaluate the consequences of main healthcare-related metrics on medical expenditures, controlling for the provincial degree specialty care doctor provide and socio-economic parameters.

The entire three main healthcare-related metrics confirmed damaging associations with the 2 medical expenditure parameters. Main care physicians per 10,000 inhabitants was considerably related to the per capita hospital medical expenditures (p < 0.05), and the proportion of public well being expenditure in complete well being expenditure was considerably related to each per capita complete medical expenditure and per capita hospital medical expenditures (p < 0.01 for each).

Our research discovered damaging associations between the first healthcare capability and medical expenditure within the context of hospital-oriented healthcare techniques in China, including to the earlier proof that main healthcare might play a constructive function in decreasing medical expenditure. Insurance policies on rising the first care doctor provide and the general public share of complete well being expenditure must be carried out to strengthen the first healthcare system. With the gradual advance of medical reform and the coverage inclination to main healthcare, this may play a extra essential function in controlling the speedy progress of medical expenditure.


Mechanical Properties of Nook Joints Fabricated from Honeycomb Panels with Double Arrow-Formed Auxetic Cores

The event of each gentle and powerful wood-derived supplies is an fascinating analysis space, significantly by way of usability in, e.g., furnishings constructions. Honeycomb panels being present trade commonplace are comparatively thick (32 mm and 40 mm), thus their attractiveness in designing furnishings is proscribed.

In just a few research, it has been proven that honeycomb panels with paper cores are characterised by unsatisfactory mechanical properties, particularly when the composite thickness is lower than 20 mm. From the literature, it is usually evident that mechanical properties may be improved by introducing auxetic options into the core construction.

Though it’s a idea with nice potential, there are just a few research coping with honeycomb panels with auxetic cores fabricated from paper. Moreover, there’s no analysis on the nook joints constituted of such materials. For that reason, the goal of the research was to check the bending habits of the nook adhesive joints fabricated from honeycomb panels with double arrow-shaped auxetic cores.

Inside the analysis, the core cell was adopted based mostly on literature and preliminary research, paper auxetic cores have been produced by means of the designed and 3d printed gadget, and joints stiffness and energy have been calculated analytically based mostly on the experiment outcomes.

Evaluated nook joints stiffness, each in compression and rigidity take a look at, is larger for samples fabricated from panels with designed auxetic cores. Surprisingly, within the analyzed vary of elasticity, it was statistically proved that the values of joint stiffness coefficient Ok didn’t range considerably between in contrast joints pairs.

The impact of the presence of kids on grownup smoking behaviour: empirical proof based mostly on China household panel research

Background: Regardless of numerous research linking household and marriage elements with well being behaviour, the consequences of kids on the well being behaviour of oldsters are nonetheless understudied. This research explored the affiliation between the presence of kids and adults’ smoking behaviours.


Strategies: This research used panel information from the China Household Panel Research 2010 and 2012, and the info set included 23,157 households and 45,513 adults. Logistic regression was carried out to analyse the affiliation of the presence of kids on adults’ smoking behaviours. Subgroup regression was used to look at heterogeneous results.


Outcomes: Full pattern regressions confirmed that the variety of youngsters was considerably inversely related to smoking behaviour (OR = 0.93; 95% 0.90-0.96). Additional subsample regression finds that such impact is just important among the many high-education group (OR = 0.92; 95% 0.87-0.97), high-skill staff (OR = 0.89; 95% 0.80-0.99) and {couples} who had an age hole better than 2 years (OR = 0.91; 95% 0.88-0.95).


Conclusions: Our findings affirm the existence of the upward intergenerational impact of the presence of kids on adults’ smoking behaviour in China. Nonetheless, such results will not be equal throughout all demographic traits. Future analysis might discover different elements of the upward mechanism and doable pathways for a stronger impact. In resource-poor areas, concentrating on cessation actions at those that have youngsters at an early age could also be an efficient technique.

NATtrol Flu Verification Panel (7 X 0.5 mL)

EUR 394.24
  • What is the product classification?
  • NATtrol Flu Verification Panel is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

Core Panel Multi-Tumor control slides

TS900 Set of 5
EUR 218

Core Panel Multi-Tumor control slides

TS900-25 Set of 25
EUR 485

Breast Panel Multi-Tumor control slides

TS901 Set of 5
EUR 218

Breast Panel Multi-Tumor control slides

TS901-25 Set of 25
EUR 485

Porcine Swine FLU virus A (FLU A) ELISA Kit

QY-E40037 96T
EUR 400

Ivd/ Rat Ivd ELISA Kit

ELI-39421r 96 Tests
EUR 886


EHF0241 96Tests
EUR 521


EGTF0241 96Tests
EUR 521

Bovine FLU ELISA Kit

EBF0241 96Tests
EUR 521

Canine FLU ELISA Kit

ECF0241 96Tests
EUR 521

Anserine FLU ELISA Kit

EAF0241 96Tests
EUR 521


EMF0241 96Tests
EUR 521


ERF0241 96Tests
EUR 521

Rabbit FLU ELISA Kit

ERTF0241 96Tests
EUR 521

Porcine FLU ELISA Kit

EPF0241 96Tests
EUR 521

IVD antibody

22140-100ul 100ul
EUR 390

IVD antibody

70R-18039 50 ul
EUR 435
Description: Rabbit polyclonal IVD antibody

IVD antibody

70R-13603 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal IVD antibody

IVD antibody

10R-4491 100 ul
EUR 691
Description: Mouse monoclonal IVD antibody

IVD Antibody

DF12284 200ul
EUR 304
Description: IVD antibody detects endogenous levels of IVD.

IVD Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

IVD Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:500-1:1000


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA12811 50 ug
EUR 363
Description: Mouse polyclonal to IVD


YF-PA12812 100 ug
EUR 403
Description: Rabbit polyclonal to IVD

Bordetella bronchiseptica proteins (inactivated vaccine for dog) for ELISA

BBV15-N-100 100 ug
EUR 286

Human FLU-H5 ELISA Kit

201-12-2128 96 tests
EUR 440
  • This FLU-H5 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.


DEIA436 6T/30T
EUR 580
Description: This kit is an in vitro immunoassay test (Dot-ELISA) for the direct, rapid and qualitative detection of nucleoprotein (NP) antigen of Influenza A Virus in human nasopharyngeal aspirates, swabs, nasal wash, chicken embryo whole virus inoculation or viral lysates, etc. It is intended for clinical identification influenza type-A viruses.

Guinea Pig FLU ELISA Kit

EGF0241 96Tests
EUR 521

Human FLU-H5 ELISA Kit

QY-E04880 96T
EUR 361

IVD Polyclonal Antibody

28898-100ul 100ul
EUR 252

IVD Polyclonal Antibody

28898-50ul 50ul
EUR 187

IVD Rabbit pAb

A15281-100ul 100 ul
EUR 308

IVD Rabbit pAb

A15281-200ul 200 ul
EUR 459

IVD Rabbit pAb

A15281-20ul 20 ul
EUR 183

IVD Rabbit pAb

A15281-50ul 50 ul
EUR 223

Human IVD Antibody

33170-05111 150 ug
EUR 261

IVD Blocking Peptide

DF12284-BP 1mg
EUR 195

IVD cloning plasmid

CSB-CL011921HU-10ug 10ug
EUR 465
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1272
  • Sequence: atggcgactgcgactcggctgctggggtgtcgtgtggcgagctggaggctgcggccgccgcttgccggcttcgtttcccagcgggcccactcgcttttgcccgtggacgatgcaatcaatgggctaagcgaggagcagaggcagcttcgtcagaccatggctaagttccttcagg
  • Show more
Description: A cloning plasmid for the IVD gene.

anti- IVD antibody

FNab04426 100µg
EUR 505.25
  • Immunogen: isovaleryl Coenzyme A dehydrogenase
  • Uniprot ID: P26440
  • Gene ID: 3712
  • Research Area: Metabolism
Description: Antibody raised against IVD

anti- IVD antibody

FNab04427 100µg
EUR 585
  • Recommended dilution: WB: 1:1000-1:6000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: isovaleryl Coenzyme A dehydrogenase
  • Uniprot ID: P26440
  • Gene ID: 3712
  • Research Area: Metabolism
Description: Antibody raised against IVD

Anti-IVD antibody

PAab04426 100 ug
EUR 355

Anti-IVD antibody

STJ117476 100 µl
EUR 277
Description: Isovaleryl-CoA dehydrogenase (IVD) is a mitochondrial matrix enzyme that catalyzes the third step in leucine catabolism. The genetic deficiency of IVD results in an accumulation of isovaleric acid, which is toxic to the central nervous system and leads to isovaleric acidemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

IVD, Human Recombinant

P1577-100 100 µg
EUR 510

IVD, Human Recombinant

P1577-20 20 µg
EUR 156

Saponin Vaccine Adjuvant

VAdv-Ly0009 1 g
EUR 1095
Description: Saponin Vaccine Adjuvant, plant-based vaccine adjuvant.

Recombinant flagellin FlicC vaccine adjuvant (TLR5 agonist); vaccine adjuvant

AV-7010-50 50 ug
EUR 895

ELISA kit for Human PLA2G4D (Phospholipase A2, Group IVD)

ELK6188 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Phospholipase A2, Group IVD (PLA2G4D). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
  • Show more
Description: A sandwich ELISA kit for detection of Phospholipase A2, Group IVD from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Goat IgG (-ve control for flow cytometry) (isotype control)

20011-100 100 test
EUR 103

IVD protein (His tag)

80R-1262 100 ug
EUR 268
Description: Purified recombinant Human IVD protein


ELI-12848h 96 Tests
EUR 824


ELI-13527b 96 Tests
EUR 928


EF010406 96 Tests
EUR 689


ELI-43520m 96 Tests
EUR 865

Mouse IVD shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat IVD shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

IVD Polyclonal Conjugated Antibody

C28898 100ul
EUR 397

IVD Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

IVD Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

IVD Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human IVD shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

IVD Recombinant Protein (Human)

RP016447 100 ug Ask for price

IVD Recombinant Protein (Rat)

RP206471 100 ug Ask for price

IVD Recombinant Protein (Mouse)

RP144596 100 ug Ask for price

BSA Control for Age-BSA

EUR 175

BSA Control for AGE-BSA

35R-AA007 10 mg
EUR 224
Description: BSA Control for AGE protein (BSA modified), Cat No. 30R-AA007

Calcium phosphate vaccine adjuvant

AV-1020-100 100 ml
EUR 219

Peanut Oil vaccine adjuvant

AV-5010-50 50 ml
EUR 225

Mineral Oil vaccine adjuvant

AV-5020-50 50 ml
EUR 225

Mannide monooleate vaccine adjuvant

AV-5030-5 5 g
EUR 164

HS15 Kolliphore vaccine adjuvant

AV-6010-100 100 g
EUR 286

Pam2CSK4 vaccine adjuvant, unlabeled

AV-9020-1 1 mg
EUR 408

Pam3CSK4 vaccine adjuvant, unlabeled

AV-9025-1 1 mg
EUR 286

Mouse Monoclonal Anti-Gardasil vaccine L1s (Human Papilloma Virus/HPV6+11+16+18 late proteins) antiserum control for ELISA

HPV618L13-S 1 ml
EUR 469

Human Influenza viruses IgG,FLU ELISA Kit

201-12-1767 96 tests
EUR 440
  • This Influenza viruses IgG ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Pig Swine Influenza Virus (FLU) ELISA Kit

abx157184-96tests 96 tests
EUR 668
  • Shipped within 5-10 working days.

Human Influenza viruses IgG(FLU)ELISA Kit

GA-E1783HM-48T 48T
EUR 289

Human Influenza viruses IgG(FLU)ELISA Kit

GA-E1783HM-96T 96T
EUR 466

Human Influenza viruses IgG(FLU)ELISA Kit

QY-E02255 96T
EUR 361

Rabbit Anti-West Nile Virus vaccine (WNV, Recombitek/DNA vaccine) antiserum

WNV13-S 100 ul
EUR 457

Frozen Tissue Section Panel - Mouse Whole Brain Segmentation Panel

T6334035 5 slides
EUR 931
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Paraffin Tissue Section Panel - Mouse Whole Brain Segmentation Panel

T8334035 5 slides
EUR 556
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Control for DOG1, 3 cases (1.5mm)

DOG1061 1
EUR 85
Description: IHC control array containing 3 GIST cases of strong, moderate, weak/nil DOG1 expressers in duplicates

Control for Ckit, 6 samples (1.5mm)

CKIT061 1
EUR 85
Description: Gastrointestinal stroma tumors, 6 cores, 3 cases in duplicates showing strong, moderate and no expression of cKit molecule.

Control for HER2, 4 cases (1.5mm)

HRC081 1
EUR 85
Description: IHC control array containing 4 breast cancer cases of strong, moderate, low and negative HER2 breast cancer expressers in duplicates

SLLK, Control Peptide for TSP1 Inhibitor

HY-P0301 1mg
EUR 133

Control for ER, 4 cases (1.5mm)

ERC081 1
EUR 85
Description: IHC control array containing 4 breast cancer cases of strong, moderate, weak/nil estrogen receptor (ER) expressers in duplicates

Control for PR, 3 cases (1.5mm)

PRC061 1
EUR 85
Description: IHC control array containing 3 breast cancer cases of strong, moderate, low/negative progesterone receptor (PR) expressers in duplicates

PAS/Glycogen, For Digestion (Control Slides)

TCS0024-100 100 Slides
EUR 706

PAS/Glycogen, For Digestion (Control Slides)

TCS0024-25 25 Slides
EUR 232

PAS/Glycogen, For Digestion (Control Slides)

TCS0024-5 5 Slides
EUR 98

Thiostatin Rat protein, control for western

TSTN11-C 100 ul
EUR 286

Control/Blocking peptide for Human WNT5a

WNT511-P 100 ug
EUR 164

Human IVD Antibody (Biotin Conjugate)

33170-05121 150 ug
EUR 369

Ivd ORF Vector (Rat) (pORF)

ORF068825 1.0 ug DNA
EUR 506

IVD ORF Vector (Human) (pORF)

ORF005483 1.0 ug DNA
EUR 95